Genes, Genomes, and Genetics, Oh My!

BACKGROUND

I plan to write quite a few posts that will require a knowledge of genetics. I had started writing a new post on a genetic disease I have exposure to, called hemochromotosis, and to do this I started writing about DNA, and genetics in general. What I quickly realized is that my readers would have to be well versed in genetics to follow all the details, and that's a lot to ask. So I've decided to undertake the task of introducing DNA to you myself. The study of DNA and genetics is so fascinating that's it's worthy of a detailed introduction. It's likely there will be plenty of modification to this post in the future to fill in any interesting and useful oversights, but for the moment, this is a solid grounding that will allow you to follow many genetics related news stories, and hopefully, my future posts. I hope you enjoy learning about it as much as I did. 

DNA
Is an acronym for Deoxyribonucleic Acid, although that does not help describe it if you do not know what nucleic acids are, so lets discuss them. Nucleic acids are composed of compounds called nuclueosides. Nucleosides are simply small compounds of which there are essentially only four types, called Adenine, Guanine, Cytocine, and Thymine, pictured below.

These are abbreviated to A,T, G and C for convenience. There are actually additional parts to these molecules, not shown in the picture above, and these are also important. They form what is called the backbone of DNA. You can think of it as akin to a scaffold, to which each of the A,T,G and C compounds are anchored. Like a scaffold, this backbone provides a degree of structural stability, which is important in biological molecules.

THE STRUCTURE OF DNA
In the same way that letters from a particular language come together to form legible words A,T,G and C combine together to form a "legible" linear sequence, or strand, of DNA. A strand could therefore be represented by a long sequence of letters as follows "ATGCTGACCGGTAATGCCGTGCA". Indeed this is how molecular biologists depict DNA sequences, and remarkably there is a lot of information embedded in this deceptively simple code. In fact, all of the information required to build a human being comes from a sequence just 3.2 billion letters long.

Interestingly, DNA does not exist as a single strand, instead, two strands combine together, aligning opposite each other. The alignment is not random, but follows a simple set of rules based on the chemistry of the A, T, G, and C compounds. Molecules of A must be paired with molecules of T, and molecules of G must be paired with molecules of C. So, for the sequence above the double stranded version would actually look like,

"ATGCTGACCGGTAATGCCGTGCA" "TACGACTGGCCATTACGGCACGT"

Once combined these two strands twist around each other to form a 3D structure called a double helix. In the picture (left) you can see how one strand wraps around the other. This whole structure is what is meant when we refer to a molecule of DNA. There is actually a great video on all of this here, I recommend it. A final point, we inherit one strand of DNA from our mother, and one from our farther. Therefore, the combined strands are a 50:50 mix of our parents.

WHAT DOES DNA DO?

In terms of what DNA does in the body, the best way to describe is as an enormous instruction manual. This manual codes for the building on an entire cell, but since each cell is different, liver cells are distinct from, bone cells, and blood cells etc, different pages of the instruction manual are used to create them. This feat of cellular engineering is performed via the production of small molecules called proteins, more on these later, but for the moment, think of them as small autonomous building machines. They're very cool. DNA determines your sex, your eye colour, the number of fingers and toes you have, your ability to metabolise foods, and partially your intelligence. This is an exciting realisation, because what it says is if you can change your DNA, you can change your physiology.

GENES

The regions of a DNA molecule that result in the production of a protein are called coding regions, or genes. They are essentially just small sections of a one or other of the strands of DNA which have the right sequence of A,G,T, and C to produce a specific protein molecule. We as humans have approximately 20,000 genes, resulting in 30,000 unique proteins (one gene can result in the production of more than one type of protein).

Because cells are very small, and there's not much space in there, DNA is packaged into more compact structures called chromosomes. DNA wraps itself around a set of small spherical shaped proteins called histones, similar to winding in the string of a YoYo. The picture below depicts the whole process very well. The end result of this compacting process is a new structure called a chromosome.

Annunziato, A. (2008) DNA packaging: Nucleosomes and chromatin. Nature Education 1(1):26

CHROMOSOMES

Different organisms have different numbers of chromosomes, but there is no relation between the number of chromosomes and the complexity of an organism. For example, a humble hedgehog has 88 pairs of chromosomes, a butterfly has over 200 pairs, whereas we have 46 pairs, 23 from our mother and farther each. 

Chromosomes are important since they are how we exchange genetic material. A single chromosome will contain many genes, for example, chromosome 6 alone contains nearly 2,000 genes, some of which are known be responsible for diseases such as hemochromotosis, diabetes and epilepsy. If something goes wrong with the dishing out of chromosomes during the formation of an embryo then the results can be enormous. Patau Syndrome, Edwards Syndrome, and Kleinfelter Syndrome are all examples of this. 

HEREDITARY GENETICS

Hereditary genetics refers to how genes are passed down from parents to offspring. Biologists will often refer to this as Mendelian genetics, after an Augustine friar called Gregor Mendel who studied pea plants in the 1850's. What Mendel discovered was that if you breed small pea plants with other small pea plants, the offspring will be small. Similarly, if you breed tall pea plants with other tall pea plants, the offspring will be tall. But what happens if you breed small pea plants with tall pea plants? Well, the answer all depends of how dominant the gene for "tallness" actually is. 

DOMINANT AND RECESSIVE GENES

The physical traits of the pea plants will actually depend on the type of gene that is being studied. You have probably heard the terms dominant and recessive before. A dominant trait is one that requires just one copy of the gene for the trait to occur in the offspring. A recessive trait requires both copies of the gene for the the trait to occur in the offspring. 

As an example, lets assume there is a gene called "T" that determines how tall a pea plants can be. All tall pea plants therefore must have the "T" gene. We know small pea plants don't have this gene, so these are denoted as "t". Think of it as a defunct gene for tallness. Since we have genetic material from the mother and the father there are actually two genes we need to think about. With two genes "T" and "t" these can combine in one of only four ways, "TT", "Tt", "tT", and "tt" and with the exception of "Tt" and "tT" they will not result in the same outcomes. 

HETEROZYGOUS AND HOMOZYGOUS

These terms arise frequently in genetics, but they are very simple. Heterozygous simply means you have two non-identical copies of the same gene, so Tt, or tT. Conversely, homozygous mean you have two identical copies of the same gene, so TT, or tt. Some diseases only arise if you are homozygous, i.e, you require two copies of the disease gene. You could also be what's called a "carrier" where you have one normal copy of the gene, and one disease carrying copy of a gene. You may not have the symptoms of the disease, but you could pass it down to your offspring. Genetics is sneaky like that!

AUTOSOMAL AND X-LINKED

It is common to hear the terms autosomal or sex-linked when reading about genetic diseases. These terms refer to the types of chromosome the gene responsible for the disease is located on. As mentioned, we have 23 pairs of chromosomes, the first 22 are simply labelled 1 through 22, but the last pair are X and Y chromosomes. If you have two X chromosomes you are female, if you have a Y chromosome, XY, you are male. The X and Y chromosomes are called sex chromosomes, while chromosomes 1 through 22 are called autosomal chromosomes. So, for example, cystic fibrosis is an autosomal recessive genetic disorder, this means it does not involve the X or Y chromosome. It's actually down to a small change in one gene on chromosome 7. There are some diseases which occur only on the X and Y chromosomes which are called sex linked diseases, or X-linked. Colour blindness is an example of this. And because men only have one copy of the X chromosome they tend to suffer more, since a woman with two X chromosomes has a better chance of having one normal copy of the gene. 

THE PREDICTIVE POWER OF GENETICS

Because of the simple rules governing the behaviour of some genes you can actually calculate the probability of a given trait being passed from parents to their offspring. So in the example above, if tallness is governed by a dominant gene then "TT", "tT" "Tt" will all be tall offspring, while "tt" will be short. The calculation can be represented using what are referred to as punnett squares, shown below.

The genes provided by the mother are shown in red, the genes from the father, in blue. The results of the combinations are shown in orange and/or white. In the first example (a) both parents are heterozygous for being tall. The result of their mating is that 3 of the 4 possible gene combinations result in tall offspring (shown in orange). In (b) one parent, the mother, is heterozygous for being tall, while the father homozygous for being small, the results of their mating will be that only 2 gene combinations can result in a tall child. Finally, in (c) both parents are homozygous for being small, and they can only produce small children. Therefore, if the parents in (a) have a child, each child has a 75% chance of being tall. If they have two children, the odds of both of them being tall are (0.75 x 0.75), or just over 50%. A similar calculation can be performed in example (b). 

FINAL REMARKS
One final thing. The term genome is becoming more common in the media. A genome is simply the set of all the genes for a given organism. I have a genome which is unique from yours. It is made of ~20,000 genes, wrapped around histone proteins and tightly packaged into chromosomes, of which we have 46. The entire set of 20,000 genes codes for ~30,000 proteins, which together build our cells, move oxygen around our body, metabolise our food and allow us to see, and move. Each gene is merely a segment of double stranded DNA, made up of small compounds abbreviated to A, T, G, and C. So, really, it's almost as simple, as A, B,C...

INTERESTING LINKS

• Some interesting information on the human genome project
• A scientific paper on DNA packaging: Nucleosomes and Chromatin
• A very cool map of your chromosomes: Chomosome Map

On Becoming a Professional Scientist

MY BACKGROUND

I am an Irish scientist trained and educated to perform research. I also live and work in Dublin. This may not seem remarkable, but I can assure you it is! I am a professional scientist, by which I mean, I make my living by performing scientific research, as opposed to having a science qualification which allows me to earn my living in an unrelated field such as banking or marketing. For those who wonder how you become a research scientist this is my experience. Keep in mind I love what I do. I loved studying science, I think it's an extremely worthwhile pursuit, and we as a society need successful scientists. 

STEP 1 - BECOMING AWARE THAT SCIENCE IS A THING

It's actually difficult to determine when I developed an interest in science, which could also be interpreted as meaning I was always interested in science. As an adult I am still fascinated by the advances and achievements of medical science. My interest was initially nurtured by TV. We didn't have the discovery channel when I was a kid, no-one did. We had six TV stations when I was growing up, my parents had no books on science, psychology, skeptical thinking, religion, philosophy, or history. I didn't know that it was common for people to have entire book cases in their houses on all of these topics. That meant that TV was the major entertainment medium, and thankfully, some of that TV included educational shows made in the UK. I remember watching cartoon called Once Upon a Time as a kid, and loving it! It was designed to teach kids about the human body, and it did a pretty good job. Although I'm not sure what's going on here in this scene!

As a kid it was the most exciting show I could get my hands on, and there was nothing even close to it on Irish TV. At best we might get to see a children's TV show which included a trip to the zoo to see some animals looking angry in cages, amazing!

As I got older UK programming continued to provide very high quality shows for those interested in science. There were two main documentary shows, Horizon, and Cutting Edge. There was also a great TV series called Tomorrows World, which introduced the latest advances in technology, I know it seems laughable now, but as a kid in the 80's-90's this was amazing! There were also a handful of other great shows, notably Rough Science, and The Royal Institution Christmas Lectures. So by the time I started secondary school I knew science was a thing you do, a profession. And I liked it.

STEP 2 - SCIENCE IN SCHOOL

I began my science education at the age of 13. My school provided a class simply called science, which included physics, biology, and chemistry, although interestingly, not some key areas of mathematics such as calculus, and algebra. There was also nothing about computer science. My experience of science education in school was poor to say the least. It's a syllabus based on learning definitions and formulas, and while that can be useful sometimes, it's not what working scientists spend their time doing. My teachers did not understand the topics, and did not encourage scientific debate. Nevertheless after six years of secondary school science education I was pretty convinced I wanted to study science in college, and was looking forward to be able to devote all my time to it.

STEP 3 - SCIENCE IN UNIVERSITY

I studied general science in UCD (pictured below) as I felt this would give me the best exposure to every subject, and allow me to decide which route I wanted to take later on. The UCD course was well designed, you study 4 subjects in first year, 3 subjects in second, and either 1 or 2 in your third and fourth years. I graduated with a degree in biochemistry, which I loved. UCD has ploughed a lot of money into its infrastructure in recent years, so the campus facilities are impressive.

Both UCD and Trinity College Dublin educate primarily for research. That is, graduates come out with a lot more theoretical knowledge than practical. Whether you consider this to be a good thing or not depends on what you want out of your education. DIT and DCU provide a lot more exposure to work experience and practical knowledge. Both systems of education have their place, but it helps to know what kind of work you would like to do when you graduate. I was pretty keen on becoming a full time academic, so for me this meant pursuing a Ph.D.

STEP 4 - ACADEMIC RESEARCH

I graduated with my degree in biochemistry in 2005. Afterwards I worked for a short time in the private sector and it was pretty good having both money and time for the first time. However, by 2006, government funding for Ph.D. study in science was looking pretty healthy, so I decided pursue a Ph.D. with the aim of becoming a professional research scientist.

THE RESEARCH TOPIC

To do this I first had to find a topic that interested me, and this is often the hardest part. There's a lot of interesting research that needs to be done, choosing just one topic to devote your efforts to is difficult. I recommend just talking to a lot of different researchers. No-one is better at selling what they do than them, and ultimately you want to work with a supervisor who is enthusiastic about what they do, and how they do it. Once you have a feel for what you would like to work on the next step is deciding who you would like to work with, again, this is a difficult process. For me I wanted a research group that was well established, but also young enough to think of doing things in a way that had not been done before. Ultimately I found this and completed my Ph.D. in biochemistry in 2011.

WORKING CONDITIONS

It is important to know how the research group does what it does. How well does the lab function on a day to day basis? How are supplies ordered? How is data generated and processed? This sounds very OCD, but it's the number one piece of advice I would give to anyone looking to pursue a Ph.D. I know of instances where the main way of collecting data is to work at 3am, over weekends, and public holidays, because the demand for that piece of equipment is less at those times. You need to know if you will be okay with this "arrangement". The experience of doing a Ph.D is different for everyone. Personally, I learned a lot, not just about my research topic, but about myself, and what my strengths and weaknesses were.

Overall, I have mixed feelings about having done it. I'm glad I've completed it, but I'm still not sure it was the best decision for me personally. By the time I'd finished my Ph.D. I had spent 15 years of my life being educated in science, half my life! What I didn't fully appreciate was that only now could my professional career begin. Until you complete your Ph.D. you are essentially still considered a student in training. It's not entirely inaccurate, but it's not particularly fair either. By the time you are a final year Ph.D. student you have spent an extensive period time in the lab, managed your own research projects, and often have extensive undergraduate teaching experience. In other words, you are useful.

STEP 5 - THE JOB SEARCH

I have written about this before here. However, it's worth adding a little more. Lets get one thing straight first however. I never expected to be rich from being a scientist, but I never expected to be scraping a living either. Especially after a decade of education, and experience. My experience of job adverts in my field have had salaries of between €12,000 and ~€35,000 attached to them. Outside of academia the salary €12,000 salary would be illegal, this was the wage proposed for a graduate research assistant, worth at least €25,000 in the real world.

This €12,000 salary amounted to €5.60 an hour at a time the minimum wage was €8.65, and it assumes a typical working week of 8 hours a day. Academic supervisors often demand a lot more than this, and they get away with it by promising to look after you at a later date. Whether they do or not is entirely up to the personality of the supervisor. A post-doc salary is ~€38,000, this is not a bad wage. However, the average contract length is about 24 months. If you are lucky, you will get a second 24 month contract, but after that forget about it. You are expected to branch out on your own, and you are too expensive to hire, compared to a Ph.D student, or new Ph.D graduate.

What's my point here? Well, educated academics are treated very differently in academia than they are in the private sector. There are far less checks and balances in place in academia to ensure that no exploitation is occurring, and I would go so far as to say it's normal for Ph.D. and post-docs to be treated badly. I would even say this bad treatment is seen as an obstacle to overcome in order to show you have what it takes. In my opinion this is a juvenile attitude that needs to be addressed.

In the end, for me it came down to luck and perseverance. I ended up accepting an internship which led to a 9 month contract, which ultimately led to a permanent contract. Without this internship I found it impossible to get my foot in the door, and I would not have the job I have now. I did need to interview for the position a total of 3 times in about 18 months, which is rough going, but now I have a job I enjoy in the city I live in, and would like to continue living in. I know a lot of my peers are not so lucky. For a lot of them their futures are far from stable, and while I understand no-one is owed a job, I think the state should be working hard to create an environment that means people can conceivably get a job that is related to what they are trained and educated to do. For a lot of research scientists this is not the case. There is simply nowhere for them to go.

There is a strong expectation in science that you will spend a significant amount of time abroad, and I'm sure it's a valuable experience, as well as career making. However, shouldn't there be the option to live and work in the country that invested in you? Whenever I encounter the argument for emigration there's a small part of me that remembers the Eamon De Valera quote “No longer shall our children, like our cattle, be brought up for export”. Yes, of course we can send our graduates around the world, and of course many of the them will thrive and prosper. Many will even come back, but I'm not comfortable with it being expected of you as the only way to make it.

CONCLUSION

Science can be a very exciting career. You will learn a lot of interesting things, you will definitely get to travel the world if that's what you want, scientific conferences are often in great locations, you will meet interesting people, and you will enjoy understanding more about how the world around you works. I graduated with a lot of other talented scientists, very capable, enthusiastic, and hard working scientists who have not been able to find a place for themselves in Ireland, or who have opted out of such an aggressive and punishing academic system because it requires too much from you.

By the time you finish a Ph.D. you are ~30 years of age. If you want a home and a family this is a bit of a problem. For example, banks won't give you a mortgage on the basis of a 24 month contract, even if you are getting a decent wage for it. Consequently, an academic career is a punishing prospect, and a lot to ask after having already spent close to a decade of sacrifice to get there.

Ireland needs to re-evaluate how and why we train scientists. We keep hearing about Ireland's knowledge based economy, but really what this refers to is our manufacturing economy. We manufacture a lot of medical devices and drugs in Ireland. But this does not call for the kind of graduates we are producing. Manufacturing is an important sector in any economy, but so is research and development, and we could be a world leader in this area.

We have the energy, our university staff are young, motivated, and love what they do. We also have pretty good infrastructure in our universities, with modern research facilities, and equipment. However, our research activities are too diffuse. Within a single small building there could be 20 different areas of research. It's not feasible. Why not select a a single area of research, an institute of 100 scientists working on the same area, sharing the resources, inspiring and learning from each other. We could have a single institute in every university that was a world leader in neuroscience research, or diabetes research, or cancer research, instead we support all of these activities, to the detriment of all of these activities.

We have some amazing scientists in Ireland, it excites me to think what we could do if we were structured in such a way that we all pulled in the same direction. Just think what it would mean to add a layer of hard working, enthusiastic post docs to the mix, with some job security, and the means to make a living.

MY Top Five TED Talk Recommendations

TED TALKS (TECHNOLOGY, ENTERTAINMENT, DESIGN)

I'm being kept pretty busy with some more detailed posts at the moment, but here's some TED talks I think everyone should watch. I really enjoy TED talks, I find them entertaining, educational, and often eye-opening. I'd like to share what I consider to be some of the best TED talks to date. They will make you think, laugh, and shake your head in disbelief. Most importantly, they will all leave you wanting more. I hope you enjoy them as much as I did.

MICHAEL SHERMER - SKEPTICISM

Michael Shermer is well known in skeptical circles. I've heard him speak a few times, and I've always liked what he has to say. Here he is talking about why people believe strange things. He also has a book of the same title that's worth reading and is a regular writer at Skeptic.com

LINK: Michael Shermer TED

DESCRIPTION:

"Why do people see the Virgin Mary on a cheese sandwich or hear demonic lyrics in "Stairway to Heaven"? Using video and music, skeptic Michael Shermer shows how we convince ourselves to believe and overlook the facts"

PAUL ROOT WOLPE - BIOENGINERING

Paul Root Wolpe is a bioethicist, with a background in sociology/psychology. Here he his talking about genetic modification. Even as a biologist used to hearing about the power of genetics, I was blown away when I first watched this talk. I enjoy it less for the bioethical concerns he raises, and more for the advances in technology he highlights during his talk.

LINK: Paul Root Wolpe TED

DESCRIPTION

"Bioethicist Paul Root Wolpe describes an astonishing series of recent bio-engineering experiments, from glowing dogs to mice that grow human ears. He asks: Isn't it time to set some ground rules?"

MALCOLM GLADWELL - PSYCHOLOGY OF CHOICE

Malcolm Gladwell is a superb speaker. He brings you on a journey rich in historical context all the while educating and informing. You will not want his talks to end, but you will want to hear the conclusion to his stories. This talk on spaghetti sauce/choice, is one of all time favourite TED talks.

LINK: Malcolm Gladwell TED

DESCRIPTION:

"Tipping Point author Malcolm Gladwell gets inside the food industry's pursuit of the perfect spaghetti sauce and makes a larger argument about the nature of choice and happiness"

SHAWN ACHOR - THE PSYCHOLOGY OF HAPPINESS
This is a funny and thought provoking talk about positive psychology, and how happiness leads to success, rather than the other way around.

DESCRIPTION:

We believe that we should work to be happy, but could that be backwards? In this fast-moving and entertaining talk, psychologist Shawn Achor argues that actually happiness inspires productivity.

LINK: Shawn Archor TED

JON RONSON - THE PSYCOPATH TEST

An incredibly enlightening talk about the nature of psychopathy. This talk is a fascinating insight into the diagnosis and "treatment" of this disease, presented in a sensitive but hard hitting way.

DESCRIPTION:

"Is there a definitive line that divides crazy from sane? With a hair-raising delivery, Jon Ronson, author of The Psychopath Test, illuminates the gray areas between the two"

LINK: Jon Ronson TED

CONCLUSION

So there you have it, what better way to spend a Sunday. If you have any talks you would like to share, please feel free to post them in the comments section below. I look forward to watching them.

ADDITIONAL TALKS OF INTEREST

• This is an amazing talk showing some cool insights into molecular biology